Category Archives: Concepts (2006-2009)

Baker’s Yeast Sonification

I’m currently completely wound up in stressing about my degree show – which is on the 19th June here, for anyone who wants to come (it’s entirely public) – but managed to fit in an entry to this competition. The task was to sonify the coding sequence of a gene taken from Baker’s Yeast. Very interesting. Unfortunately some sort of technical problem means that my entry hasn’t appeared on their website yet :-/ I’ve made two versions. One is less manipulated, the second used extra processing of MIDI signals to modulate parameters – feat. jiggerypokery by Fred Baker.

Version 1

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Version 2  (feat. Jiggerypokery by Fred)

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Here’s my desription of concept;

This piece explores the intricate thought that is required to comprehend how such simple representation – using the letters A, T, G & C as symbols – can actually contain the instructions for life, any life, to exist (even something as humble as Baker’s yeast). Taking the coding sequence as an independent entity, I’m trying to expose the inherent simplicity, but use sonic aesthetics to be suggestive about implicative complexity

.. and method;

I recorded myself speaking A, T, G & C. Then I wrote a simple program to send MIDI messages corresponding to the coding sequence, into Ableton Live, where the sequence was recorded- forming the core of the piece.

Post production involved manipulation of the pitch and timing of the sequenced samples. An additional percussion track and effects sends add depth. Plogue Bidule was used to manipulate MIDI signals which modulate parameters in Ableton Live.

The meter quickens throughout the length of the piece, building to a crescendo at the end.

This is the coding sequence that I used;

ATGAGTAGTTTGTGTCTACAGCGTCTTCAGGAAGAAAGAAAAAAATGGAGAAAGGATCATCCATTTGGATTTTATGCCAAACCAG
TTAAGAAAGCTGATGGGTCCATGGATTTACAGAAATGGGAAGCTGGTATCCCAGGCAAAGAAGGTACAAACTGGGCGGGTGGTGT
GTACCCAATTACAGTCGAATATCCAAATGAATATCCTTCAAAACCTCCAAAGGTTAAATTTCCAGCCGGATTTTATCATCCAAAC
GTGTATCCAAGTGGCACAATATGTTTAAGTATTTTAAATGAAGATCAAGATTGGAGACCCGCCATCACGTTAAAACAAATTGTTC
TTGGGGTTCAGGATCTTTTAGACTCTCCAAATCCAAATTCCCCTGCTCAAGAGCCTGCATGGAGATCATTTTCAAGAAATAAGGC
GGAATATGACAAGAAAGTTTTGCTTCAAGCTAAACAGTACTCTAAATAG

Sonification is really exciting. Hope you enjoy it.

Data Sonification

I’ve been thinking about Sonification (has a definition on Wikipedia, even if it isn’t a real word) of data for sometime. My first experiment used this blog. A hidden iFrame on the main page opened a page on a web server running off my laptop. These requests were then converted to audio and played out of the laptop’s speaker. I’m interested in the concept of listening to data all together, and in particular web / internet data is especially intriguing. Similarly I’ve recently become inspired by autonomous art works, things that do their own thing without intervention, and even better than that they do something entirely unpredictable.

My research has progressed, and now rather than using a simple PC speaker my software outputs MIDI information. That can then be interpreted by all means of other software, or even hardware synthesisers to actually turn the data into sound. Also I’ve stopped using this blog as the data source, I’ve actually obtained a months worth of web server log data. This has given me about 7 million records to use as my data set. Due to the way the software processes data the amount of time that it would take to “play” is equal to the amount of time that data took to collect. So, the months worth of data I’m using currently would actually take 1 month to listen to. Here’s a few excerpts from my current set up.

Example 1

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Example 2

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Example 3

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

Example 4

Audio clip: Adobe Flash Player (version 9 or above) is required to play this audio clip. Download the latest version here. You also need to have JavaScript enabled in your browser.

The “rules” that the software adheres to are as follows.

  • MIDI note is determined by an addition of each segment of the clients IP address, which is then divided by 8. The reasoning behind this is that there are 128 possible MIDI notes. The sum of IP address segments has 1024 different possibilities. 1024 / 8 is 128; so this calculation will always provide a valid MIDI note.
  • Length of note is determined by looking at the length of time in between web requests. This means in busy periods the software produces lots and lots of notes, whereas at quiet times (in the middle of the night) very few notes are played.

In time I’d like to further develop the system, exploring using other things as parameters with which to modulate aspects of the synthesis. One idea is to look at the geographical location of the client and then alter the sound accordingly in some way. This could work very well with a multiple speaker set up. Also plugging the system into the live log data would be really exciting.

A further development would introduce a visual element to the software. Illuminating variou screen sections according to IP address processing, like the audio. I haven’t looked into that as yet though..! It would probably mean transferring the MIDI processing code from VB into Processing; no bad thing me thinks.

Baker Tilly Comp

I’m going to pitch some HDR photographs to Chartered Accountants Baker Tilly. The concept is to show Manchester financial architecture, new and old, in stunning HDR.

I visited the site of Baker Tilly’s offices last week to get a feel for the place, it’s around Hardman Square in Manchester. I only managed to take 2 shots before being moved along by a security guard. It was still useful to get some test shots and have a look at the site. These aren’t actually HDR, but are “pseudo-HDR” generated from single RAW files.

BtAnim: Processing Animator + Bluetooth V1

I’ve spent a couple of days this week working with Processing – a programming environment designed for artists and designers. I’ve found it surprisingly fun. It happens very rarely with software, that you just identify with it straight away. It happened with me and Ableton Live, and that has culminated in my album.

Anyway. I’ve managed to create something – currently extremely unimaginatively titled BtAnim. As with a lot of my work it is really just a framework for something else to happen. How it works is this;

To begin with BtAnim just displays the starting image on the screen. Anyone who sees it can add their own frame to the animation, by taking a photo on their mobile phone and bluetoothing it to the computer. If you watch the video example here, you will see that as time goes on, more frames are added (although the video is just from my own testing) just as they will be when people are contributing their own images.  That’s it.

I thought it would work really well in a public place like a shop window or something.

Technically it is my usual mish-mash of hacking together some code in Processing, using BlueSoleil for the bluetooth component and PHP to monitor incoming files. Watch this space.

Keeping Busy

I need to keep busy over the Christmas break from University. Although the year is normally split into 3 segments, this year (the final one) is basically split in half. And I’m at the halfway point. So I need to keep up with making things, writing things and formulating what I’m going to do at the end of the year. Here’s a few things that I want to get on with.

Continue reading

Distributed Video Feedback

Feedback is an immensely interesting subject with many philosophical facets and a massive array of applications.

I’d like to set up a feedback loop that is distributed among remote locations. For it to work I’ll need to have two computers, each equipped with a camera and an internet connection. The screen on computer 1, will show the live video feed (streamed through the net) from computer 2. The screen on computer 2, will show the live video from computer 1. The cameras attached to both computers would point at the screens.

Adding some kind of moving subject infront of either camera would possibly produce more interesting results.

It would be ideal to increase the number of computers in the chain. The more distributed (and global) the better. Degredation of quality, however, would probably ruin the image after a few iterations – though maybe it would actually create something really good.

Web Server Art

If you run a website, or put a web server online, it shouldn’t take long before you start getting hits. Most of the hits are from automated bots, but still you get them. Following on from my previous post, I thought it might be interesting to have a custom web server that produced sound directly from the HTTP requests that it got; whilst still delivering the HTML content to the requestor.

Hmmm.

– Update, I’ve just hacked together a webserver that will make my laptop beep everytime there is a hit on it. So- if you’re reading this then make my PC beep by clicking here.

Sound As Data & Data As Sound

I’m going to explore the audification of data. It would be fantastic if I can get ‘inside’ a data set by audifying it. Daniel Cummerow’s work with algorithmic music is really fantastic and revealing, and working with mathematics is attractive.  I may take maths as the starting point – its easy to transform maths into sound, they go hand in hand – but ultimately it would be nice to have some kind of more Universal generator that can take in any database and with minimal interference produce a sound work.

One possible approach would be to use web activity as the data source.

How about a website that produces a tone. The frequency of the tone could be denoted by the number of visitors – or some other factor that is effected by the visitation. Java.. Get Sam to help!

Textual Twitter T’ing

I’ve just returned from a trip to London, with mixed fortunes. I didn’t do quite what I wanted, but I’ve come back inspired. Its culminated with my mind being full of art stuff that I want to do – at some point. Twitter is going to be my starting point, as a dataset to work with. Anyhow. This is the story.

I failed to go to a party at Lo Recordings, which Leo invited me to, which was annoying. As it happened I made it to Old Street, and was waiting for a bus there, when my mobile phone died. It took with it the address I was going to, the contact numbers of the people there and any chance of finding the place. So I took the tube back to Fulham where I was staying. Effectively making a 2 hour round trip to nowhere. Making matters worse the travelling between Fulham (West) and Central & East made it impossible for me to go and see the first ever Starting Teeth gig – which was another annoyance.

On the plus side, I briefly met both members of Starting Teeth and Nathan Fake in some bar on Brick Lane. And indeed, it was the first time I’d ever been to Brick Lane so that was cool too….

Continue reading

Hypercondria Movie

While “researching” my Hollyoaks concept I came across a similar idea, but simply supplementing Hollyoaks for Hypercondria.

Again, like the soap operas, I suffer from this terribly. Horrendously in fact. And so do many of my peers. I think it will work well!

I think the Hypercondria, Hollyoaks and Commuters are all good ideas. Maybe the three could become one longer film?

Chinaman

Recently Chinese artist Feng Feng (pictured) made a return visit to our University after some of our tutors visited China last year.

Photo of Feng Feng

It was a really nice change to get a completely different approach to leading a lecture and its delivery. I was the first time I’ve attended a lecture that was conducted in its entirety in a foreign language. I think that added to the lecture in a strange way, it definitely made me concentrate a little more.

The mans charisma flowed like a river, something which I guess helps you achieve anything. Except scaring someone maybe.

I found that Professor Feng certainly spoke about his own work in a different way to what I’m used to; he seemed completely free from worry about how his work was perceived. It seemed like he was of the opinion ‘my work is what it is, and who am I to tell anyone any different’, rather than a more dictatorial approach that I’m used to.

I can’t say how much I appreciate this – even if it is not reflected in my own practice.

Feng Feng also instantiated a collaborative piece of work for our University around concepts to do with the human body and although this sounded great, I’ve ended up not being involved in it. Mainly through being preoccupied with other stuff.

I did come up witha couple of ideas that would have worked though. The first revolved around an incident between me and my girlfriend when we were at the Benicassim festival in Spain. At about 3 o’clock in the morning, after having rammed a falafel and a tortilla down us and still nursing the bottle of cheap Spanish liquor that we’d smuggled past the entry guards (they don’t do it by halves in Spain, they had guns!) I went in for a rather-too-exuberant kiss. The end result of this was that I lost a small section of my front tooth! Despite Caiti’s less-than-perfect dental health I came out the looser, and I suppose I’ll have the reminder all of my life (until dentures are a neccessity at least).

My other concept was to make some observations about how bodys work. What do you need to put in? I thought it would be interesting to account for all of the calories that I consume, and how each of those came into being. I’m really interested in quite how much entery I personally consume, and how much all of us consume. The concept is no more developed than that however.

This is an extract of his statement, from his website.

We have a history once grand but not forgotten. Time washes away the insignificant pieces and also permanently marks the milestones. A pat romance, the memories worshipped with deep passion as the colors of the past fade. The storms and lightening of history leave us their marks of divine madness and violence. Let us stand back and observe it, grasp it and sense it …the magnificence, power and charm, dignity and mystery…

Incidentally I used the word “instantiated”. I’m not sure if its correct, but I liked it. According to thefreedictionary.com it means:

To represent (an abstract concept) by a concrete or tangible example

Just a warning…. :o)

Hollyoaks Film Idea

I’m quite a sucker for TV soap operas. At the time of writing my only two serious addictions are Neighbours and Hollyoaks. One of the strangest things when dealing with a soap addiction is the oddity that normally the lower the quality the more enjoyment that is derived from it.

I massively relish the abysmal acting, scripting writing and production. Without the poor elements it would be much more unpleasant to watch these programmes.

I’ve spotted various members of the Hollyoaks cast in my lifetime. The first was a sighting of “Sol” (Paul Danan, star of Celebrity Love Island) in Liverpool Airport. I also saw a bloke who played a rapist at the weekly comedy showcase, Mirth on Monday, at Iguana Bar in Chorlton. After some thought I figured that I actually know a lot of people at at some point or other have seen a member of the Hollyoaks cast in-the-flesh.

For sometime I’ve actively been asking people if they’ve had any encounters with the sub-celebrities that make up the Hollyoaks cast, and sure enough, loads of people have seen them. Each report usually comes with some kind of amusing story as an accompaniment.

I’d like to make a movie using Hollyoaks as a starting point. My plan is to interview people (friends and strangers) asking them if they’ve ever seen a Hollyoaker. I’ve never tried anything like that before, but I reckon it could work out great. It also fits within my self-set remit of working with (to use the technology phrase) “user generated content”.

Cosy Cosilli

Whilst writing I’m listening to Happy Snail by an artist called Cosy Cosili, also on Creaked Records (my record label). Its really quite funny, the album is about a snail, also called Cosy Cosilli. Although word-less, the music certainly makes me think of snail-based things. Its great! You can listen to it on last.fm.

Second Life Art

I’m collaborating on a project with various people on my course to create “David Bowie World” on Second Life. That is a separate post on its own – but its got me to thinking about a few things:

  • Geocaching for Second Life (or a Geocaching-like game)
  • Photobombing for Second Life
  • Travel-bug games for Second Life (passing a “token” around many people) – this is my favourite. It’d be cool to track the bugs path through SL but also track where the people involved are in real life.

Feedback Things

I’ve started working with Zimmy on creating an multi-faceted installation based around audio visual feedback. It stems from Zimmy’s experiments with pointing video cameras at projections of what the video camera is looking at… thus creating a feedback loop.

It is hugely fun, and awe inspiring in a way- I really love things that make you stop and think about all the technology we’re using day-to-day. Normal usage doesn’t have this effect. With the video feedback it really makes you stop and think about how it can happen, and therefore how the components in the loop can actually function.

Collaboration

I think our (my & Zimmy’s) aim is to create an interactive installation, whereby everything you can see and hear is created by feedback; yet both audio and visuals will be controllable by the audience (or at least influenced by them). I’ve created a system whereby an audio feedback loop is created and then modulated by movements of a Wii remote controller- I’m pretty pleased with it! It sounds good (reminded to self, make a video for demonstrating this…)

Some Research

There is a plethora of many existing Wii hacks, and even more examples of using feedback principals to augment or create audio (and video) – I’ve done quite a bit of research into GlovePIE. It is a simple programming language that allows you to program the information from the Wii remote controller. I am only using two factors from the Wii remote – the “roll” and the “pitch” of the device. For my purposes I then convert that to a MIDI (MIDI is a standardized protocol for communication between electronic music devices) signal which is finally sent into an audio program – I am using one called Ableton. Ableton then processes the signals and changes various internal parameters to control the feedback.

I’ve also done quite a lot of practical research experimenting with shepard (or risset) tone generators. According to WikiPedia a shepard tone is;

A Shepard tone, named after Roger Shepard, is a sound consisting of a superposition of sine waves separated by octaves. When played with the base pitch of the tone moving upwards or downwards, it is referred to as the Shepard scale. This creates the auditory illusion of a tone that continually ascends or descends in pitch, yet which ultimately seems to get no higher or lower.

Although not a feedback element itself – its something that Zimmy wanted to use in the audio-element of the work. In my feedback machine using the Wii remote, a shepard tone modulates any audio signal it creates… which will then be fed-back. I’m pleased with the result, although it can sound quite harsh if you aren’t careful.

So far I’ve only used the sensors in the Wii controller that sense whether it is pointing toward the floor or the ceiling and whether it is on its front, back or side. They also have accelerometers, sensing what direction it is moving in – although I find this hard to work with. Finally, they also have an infra-red based ability to tell exactly what the remote is pointing at. In games the infra-red sensor is used for things like pointing guns at enemies or drawing a circle round something. Using the GlovePIE software I talked about earlier you can use this to control the cursor on a computer screen.

In theory (and practice, it turns out) it should be possible to “paint” on-screen with the remote. Combine the on-screen painting, with Zimmy’s video feedback loop, with my audio-feedback loop (which is controlled by the same remote control as the on-screen painting) and there you have it… I’ll put this to Zimmy, and see what he thinks.

Whilst researching other Wii painting projects and things on the internet, I discovered Johnny Chung Lee‘s website. He has done quite a lot of really amazing work with the Wii controllers – much more sophisticated than what I’m trying to do (but I think we have different aims, after all). What I learned from his site was that the Wii controller actually has a high-resolution infrared sensor on it (which works in conjunction with a little infrared emitter that you put on top of your TV, for gaming). Its very high resolution, and very sophisticated. Johnny Lee’s videos demonstrate various things including “painting” but also using the controller as a so called “multi-touch screen” and interactive white board applications – all at a fraction of the cost of the normal hardware required for these applications. One of the coolest is using your fingers as points for the sensor to see.. see it to believe it. Brilliant!

Fingers

Interactive Whiteboard

Commuter Stories

I love “The Commute” and hate it all at the same time. I don’t do it anymore, at least at the moment, but when I did I saw the daily monotony as a horrible chore but also recognised some kind of beauty in it. To explain; despite the abject terror it sometimes creates, not to mention to terrible frustration, it does signify “our” (the West, I guess) amazing talent for organising things and “progress” (whatever that means).

As well as the symbolism of what the commute represents, I love the patterns. The same as the cycles of the moon, the seasons, the tides (which are of course linked to the moon and the seasons) – almost everything in the natural world operates in patterns and cycles of some kind. We have created our own similar patterns. Of course they don’t just exist with the daily commute but that is the particular example I’m interested in.

There are many different ways I could take my interest in the subject, but the thing that really interests me is how if you embark on a regular daily commute everything is almost always exactly the same, but it is always a little bit different. Subtle change is constant, but virtual-constancy is permanent regardless. NB sounds like another Dylan lyric, it is brilliant:

Talkin’ World War III Blues, last verse:

Well, now time passed and now it seems
Everybody’s having them dreams.
Everybody sees themselves walkin’ around with no one else.
Half of the people can be part right all of the time,
Some of the people can be all right part of the time,
But all of the people can’t be all right all of the time.
I think Abraham Lincoln said that.
“I’ll let you be in my dreams if I can be in yours.”
I said that.

I’d like to explore this with a documentary film, taking the same route each day; to notice and remark on the things that stay the same, the things that change and document encounters.

My problem with this, is that I don’t think I have the guts to actually do it. I’m quite shy around most people. Maybe I require a bolshy partner.

Anyhow, plenty of other things to be on with for the time being….

Disperate Magazine (.com), Architecture & Giant Mirrors

Until June this year, I lived with an architecture student. As a result, I’ve had many discussions about the subject, mainly in relevance to my friend’s (Matt) study and practice. Its a subject that really inspires me. A significant factor in contemporary architecture seems to be the prevalence of symbiotic, bland, and ever-similar designs in all, or at least many, of our cities and towns.

Everywhere I go block after block of seemingly identical residential and office buildings spring up. Week after week.
Making matters worse, these entirely uninspired architectural works, are the very things that today’s up-and-coming affluent young-professionals aspire to own and live in.

Although I would love to be in that such a “flush” position myself, actually aspiring to reside in such a dull and everyday entity seems an awful prospect.

It has sprung to mind, because over the weekend I assisted another friend in setting up his website for a forthcoming publication, in paper and online, Disparate Magazine. I think one of the key areas that the magazine is set to have a standpoint on is potential disconnection between a place, what that place actually represents, and the actual buildings that make up the landscape; especially with regard to the urban built environment. Its a complex subject, but certainly one that I’m interested in.

As an aside, this then got me thinking about my one, grand, architectural idea. Its something that I’ve been thinking about since well before my days as an artist. I may have come up with the idea originally at school, but I can certainly remember thinking about whilst sat in my office at Hilmore House, working for Morrisons Supermarkets.

Sunlight was a precious commodity, in my eyes at least. For some of the year, for some of the daylight hours, my office would have plenty of sunlight streaming in through the windows. However, much of the time was spent admiring a shadow on the opposite side of the road slowly working its ways up the buildings. I could see the powerful and precious light, within a few meters of where I was sitting; yet it was never rarely actually reached me. I was forced to sit and wish I were sat in the sunlight.

Although the idea came whilst sitting at my work desk, in front of a computer screen, I’m continually reminded of the problem. Any town or city I visit; inevitably one (or both) sides of a street suffer in someway. Our precious sunlight is continuously blocked, wherever you are. For instance, almost all the streets in the centre of Manchester are lined with buildings so tall, that throughout most of the day one side of the street is always plunged into darkness; and its the same story in any city you choose to visit. Even smaller towns have the same issue. It even extends to residential streets; often some houses are deprived of a huge amount of their light due to shadows cast by surrounding buildings (or such like).

I was reminded of it again – and again discovered an idea that I came up with, but someone else has also come up with entirely separately – whilst watching a TV documentary yesterday. It was a programme about “the Sun”, in general, but featured a small town in Austria. The town sits behind a huge hill, and for 8 months of the year gets absolutely no sunlight (resulting in high cases of Seasonal Affective Disorder). The SAD affect is highlighted here, because the town just over the river, which doesn’t sit in the shadow of the hill, has far fewer cases of SAD. They have come up with the same idea that I had; use a series of giant mirrors to bounce sunlight around and provide it to areas that don’t receive it naturally.

Although not implemented yet, there are plans to build a network of mirrors around the town so that through the winter sunlight will be available to the townspeople.

My concept has mainly been focused on cities; I envisage setting up extremely large mirrors on the tops of city buildings. There mirrors will track the sun, and move to the correct angle so as to redirect the sunlight (visible at the top of the building) down to street level. The same could be applied anywhere though; on a much larger scale in the deep and dark valleys of the Alps in Europe (and doubtless many other similar places throughout the world). The valleys could have access to the natural light. Light that has proved health benefits.

I must develop the concept further, and get some drawings done.

Something that I’ve always loved, is “remote control”, and I think that this has shades of that in it. I used to have a train set, and the thing I loved about it was not necessarily the trains, but the fact that they could be controlled without touching them. I knew how it worked, the electric circuit was obvious to me; but somehow it intrigued me immensely. This has continued throughout my life, with many remote control toys and gadgets. Most recently my immersion in using the Internet, both for “business and pleasure” (as it were) has meant I have access to hundreds of other permutations of the idea of controlling something through a distance, or without actually touching it.

I can access my home computers from anywhere, not just the files, I have remote control of the actual computer. I can get my email sent to my mobile phone. I can control my computer through my mobile phone. I can send information to my websites through mobile, email, web. Even a BT payphone would allow me to update my websites. Adding imagery into all this, I can actually look into my own home, from anywhere in the world, and get a live picture of whatever is (or isn’t) going on there.

I think the giant street mirrors, are born from this interest in remote control. Its an almost identical “joy” that I experience thinking about it. It is even better in a way. Although all the internet and technology things are extremely clever, and that interests me no-end, the fact that a mirror is such a simple and “understood” (by almost anyone) thing I think it adds to how accessible and really “real” the concept is.

Speech Play Ideas

I used to live with a linguist and we often chatted about how words were formed aurally, psycho-linguistics and etymology. I’m also just personally interested in accents and what people sound like. I’m sure my interest stems from being born in Yorkshire, and growing up there, but having parents who both spoke with fairly bland southern accents. My accent has now become amorphous to whatever environment I’m in, but I used to have a significantly different accent to my peers and friends at school. I never felt stigmatised, but maybe it sparked this interest. Language in general and particularly links and differences between the European languages also intrigue me.

I’m considering the idea of dissecting some words into their component syllables, then writing each syllable in a variety of different ways. Each “iteration” will only have one change from the previous one. For instance with the word “singleton”;

Sin – gle – ton

Cin – gle – ton

Cin – gal – ton

Cin – gal – town

Cyn – gal – town

Cyn – galle – town

Cynne – galle – town

Cynne – galle – touwn

I thought this would make an interesting animation manipulating the form of the words as they appear on the page. Also I think it would be a nice documentary-style film asking people to read through the different versions, but out of sequence. The idea with that would be that they were not entirely sure what the word they’re trying to say is.

Maybe a combination of the two formats. Who knows, this is just an idea at the moment.

Spy Phone

I recently purchased a modified Nokia phone, that lets you set it into a “spy mode” – whereby the phone appears to be off but will actually automatically answer any incoming phone calls; without any visible signs. Its designed for un-trusting types to spy on their friends, employers or loved ones. Fortunately, I’m in a position where this is not by primary intention!

I thought it would be cool to do some kind of interactive art work with it. When my University tutors asked me to look at the Urban Legends stories, I thought it’d be fun to create an Urban legend of my own. It would start, in lavish style, in a toilet. Graffiti on the walls tells the story, and concludes with a “real world” factor – a phone number. If anyone is inclined to phone the telephone number, they would be connected to my subversive spy phone – which resides in an undisclosed location. What the caller is listening to is…… in the eye of the beholder. I guess.

Spam Art is Go

I’ve rigged up a pretty good version of what I want to do with my spam based project. Spart is the name I’ve coined, rather unimaginatively. Since I’ve got so far with it, I think I’m going to give it a dry run, mainly to see what kind of result I get, and hopefully provoke a good reaction from the (potential) “victims” of my mailings. My previous post about spam and art is here.

Hang on! I got an email….. what does it mean?

Firstly sorry again if this has brought you to annoyance and if you wonder how I did this; your email address exists on the world wide web, somewhere. It doesn’t mean too much on its own. If you would like for your email address to be removed from the system, there is a link at the bottom of any emails you have received from me.

Contribute

I’m asking anyone who receives one of my spam emails (or anyone else) to contribute a short message to the project. These contributions will then in turn make up the content for my next mass-mailing. Ultimately I would like the system to be completely self contained – so all the messages that are sent are generated by other people who (at one point) received a message. I will then place the computer(s) running the system into a gallery, and display all outgoing and incoming messages that it generates. This is a little way off, b ut not impossible.

Use this form to add your message to the spam system. Anything that gets sent out will be moderated, so there’s no point including any obscenities in it. If you would just like to leave a general comment click here.

Cheers!

Art Spam, Spam Art, spArt I suppose

What is Spam Art?

I have a new harebrained “artistic” scheme. As the title suggests it is to do with spam.

I read about something I thought that was cool; a guy had simply created a dedicated email inbox and ensured that it received lots of spam all the time (not too difficult these days). Then a computer printed all of the messages that were delivered into that inbox and immediately the paper it was printed on was shredded.

I liked it – but a little one dimensional I suppose (I probably wouldn’t have said that if I’d have thought of it first and done it, however).

Another interactive art work I read about, that utilised the Internet, was the guy that had a balloon rigged to an air-pump that was triggered by hits on his blog. Anyone who looked at his blog could rest-assured that their hit, inflated the balloon that little bit more – at the end of one day the balloon was popped.

I really loved this concept. I’m not sure quite what it was meant to represent, but it definitely appealed to my tastes.

Try googling “spam art” – loads of cool results.

My Ideas & Testing the Concept

What I would like to do started with the idea of running two pieces of software on a gallery-based computer. The first program continuously spiders the web and builds an ever-growing database of email addresses. Despite the spam it attracts there are still millions and millions of such addresses out there on the web. The second program would send a message to each of the emails that the spider discovers.

Responses to the sent message would also be displayed by the computer and be published on a blog.

I guess I’m interested in turning the tables on spam, so for somebody out there they will receive my spam and be surprised and joyed at the fact that it isn’t actually the traditional form of spam. If they respond they will be interacting with anyone who looks at the gallery-situated computer or the blog. Thus my interactive art is born.

I tested the concept with a few hundred email addresses that I collected using a simple spidering program, and this has generated a few replies – mostly encouraging. One or two slightly angry or annoyed…. not surprisingly (I am sorry..!)

Take a look at the email I sent here.

The responses have ranged from;

Hi, what exactly is the purpose of this project? And what is the “art” for this project?

To lovely and encouraging responses like this from Anne-Marie;

I am always very happy to see that Students “in general” still have
ideas ! (you are the future my Dear…and the world depends on you all)
:-)

And this is the major point that I have to address:

How is art different from spam?David K

Many thanks to everyone who did respond – you’ve helped me a lot.

Also another huge debt to the open source developers who wrote PHPList and all of its components.

Where’s it going?

Well there is quite a development overhead with a project like this; for it to work seamlessly. For my initial test I’ve been filling in all the gaps that ultimately a computer will have to, but I reckon it has proved the concept well.

I’ve refined the idea through the testing. The part of the project that I really want to nurture is the relationship between the email content and the people that receive it. That was one of the most interesting concerns of the people that responded; the content must be relevant or of interest somehow – otherwise the email still constitutes itself as spam and will not be enjoyed by its recipients! So where do I find the content for emails so it will be relevant?

My current thinking is that all the emails that are sent to members of my spam list will actually be generated by users through a website. The website will serve as a medium for any single person to communicate a nuance of thought to (potentially) many thousands of “subscribers”. It can also be a hub for responses generated by any of these “spammed thoughts” to be displayed on the web. I’ve also concluded that anyone who receives these emails must not in an unsolicited manner. It just doesn’t quite sit right with most people (or myself).

Geocaching; Personal Procrastination

I’m becoming increasing frustrated with my inability to record my music in a efficient manner. Procrastination is a big problem as is occasional lethargy. Also I find it difficult to defer my desires to mess about with my various other projects that are on-going.

Today’s procrastinative displacement activity is giving some much needed attention to this blog.

Photobombing has attracted some comments from various people on the internet and is still smouldering away by itself, which is really encouraging. I really want to get it properly sorted, so its a more cohesive system and accessible to anyone (which unfortunately it is not at the moment). I think that is going to involve quite a lot of re-learning how to program – but should be fun in its own right.

I was particularly pleased yesterday when I stumbled across Imran Ali’s blog and his post about photobombing. Its so good to see/hear/know that people other than myself are attracted to the concept. Imran summated photobombing with this, it isn’t quite correct (I don’t think) but this is probably how photobombing should operate:

I guess it’s basically the inverse of geotagging, rather than tagging a digital map with digital photos, you tag a physical place with real photos :)

A (cool) twist of fate is that he discovered the concept of photobombing via geotagging which is something I’ve been extremely interested with lately.

Speaking of geotagging, I’ve finally got my mobile phone/bluetooth GPS and camera combination to work smoothly, so in future I can ensure all my photographs will be geotagging automatically. But I’ve also discovered the phenomenon of geocaching. What am amazing thing this is. A network of “cachers” maintain thousands of caches throughout the globe. A cache can be any sort of container, and will contain a log book and official geocaching.com paperwork. Sometimes there are gifts inside, or puzzles, riddles, clues to find another geocache – anything! Anyhow, all the cache’s and their GPS co-ordinates are available on the website and anyone who so wishes can go in search of them. Its great fun, I recommend it to all.

I am certainly going to combine my photobombing escapades with geocaching.

Sometimes I wish time went twice as slow, or me twice as fast.